Democratic Underground

Archives: January 29, 2004

So I asked a Hummer owner...

Thanks for the memories...

Truth catching up to Bush

CounterPunch Website Down?

Forget politics; plow the snow - Coleman's Star Tribune

What Tax Cut?

Leaving Dean (my new 'toon...sorry, Deaniacs)

Minor correction......."The Cost of Tough Talk"

Besmirching the tricolor - France, Taiwan, China

Balancing the books on the backs of the little guy

A 9/11 COVER UP?

So Long, and Thanks for all the Fish: A Warhawk Flies the Coop

SA widow tells of hubby's last call from Iraq

NY Times: The Dead Center (MUST READ)

The robbers who work on Capitol Hill

Re "Halliburton Says Worker Participated in Kickbacks"

WSJ today. Who writes this stuff?

Roy Disney slams Eisner and ex-Senator Mitchell

Mass Appeal (new populism in Dem race)

DU Article by punpirate: The Costs of Tough Talk

Kerry turns to the 'band of brothers'

Why hacking the U.S. Senate is apparently A-OK

Crossman: Europeans Are Not Cowards

Jonathan Freedland (Guardian Utd): They'd call it Whitewash

Taiwan's democracy has need of America

Seumas Milne (Guardian Utd): The shadow of Iraq

Salon: Enter the Ayatollahs (Democracy in Iraq)

The Nanny in Chief - Sullivan's TIME oped

So Long, and Thanks for all the Fish: A Warhawk Flies the Coop

GU: 'There but for the grace of God go all of us' (UK Iraq Intel)

International Child Advocacy Group Seeks Award Nominations Worldwide

E-mail Gary Hart!

Suggestion: mute all SuperBowl ads

visit KANSAS CITY !! 9-11 widow Mariani and Attorney in KC Feb. 22

May First, Protest for Health Care Reform, May Day!

Bernie Ward is at 'em again.

Liberal Talk Radio Audio Archives!

new editorialists in newspaper

Israelis better at manipulating media

Question about Readers' Digest

Bill Maher on Larry King now (re-broadcast)

Will Novak show up for work today?

CBS Defends Scrubbing Anti-Bush Super Bowl Ad

Chicago Sun Times Boycott?

Has anyone heard of Sinclair Broadcast Group?

Minneapolis St Paul Media Whore watch

Salon: The conservatives are outraged -- about Bush

Fmr. Assitant Treasury Secretary compares and contrasts slavery to today

Usenet post on neo-conservatives.

Phe's shared thought for the day 1/29/4;

Comics' 'Cathy' getting married?

Isaac Asimov on Skepticism

Growing Priesthood Dissent On Vatican Anti-Gay Rhetoric

RW converts to the fact that GLBTs are EQUAL: One At A Time.

UN To Provide Same-Sex Partner Benefits To Non-US Workers

Arizona Pressures Congress To Amend Constitution

Canadian Gay Activist Awarded Country's Highest Honor

Care to weigh in on gay marriage in a "mixed" forum?

'We Will Stop Activist Judges' Senate Leader Declares

Dear Mary Cheney:

HP takes steps to boost employee morale

Update: Time Warner makes 2003 gains, despite AOL drag

Sony sees profit drop on increased expenses

Amazon records first profitable year in its history

US throws a bone to Africa

Fidelity Investments...Friend or Foe?

Siemens to cut IT budget by $1 billion

White House to Project Deficit of $521 bln in 2004

Bush tax cuts: help needed...

Southern African Drought Worst In 10 Yrs - Lesotho Crops Total Loss

Hunters, Anglers Blast Energy Bill

Silt may be causing fish to go belly-up

Multiple Insect Infestations Will Change Colorado Forests For Generations

New form of matter created in lab

Frying pan fumes 'kill canaries'

Ma's democratic credentials queried - Taiwan

China's defense advances due to some friendly help

TSU embraces 228 rally - Taiwan

East Timor pushes for new hearing

Taiwan's jobless rate maintains 2-year low of 4.7%

Millions face hunger - SA

Angola drives out Congolese

Shiites hold huge protest in southern town to demand local democracy

A history of Saddam in Sinatra time...(Blumrich Flash)

Tibetan Nun's Path To Asylum

Al-Mada?

I hear the F-14 Tomcat is to be phased out by 2008

Civil war possible in Iraq?

2 more go to jail for anti-war beliefs

Bill would cancel ban on gun used in self-defense

Dupe

Gun Control in Chicago Works

Taking aim at stereotypes; Gun club arms gays, lesbians

Americans want protected gun rights

GUNS IN THE NEWS--January 29, 2004

Why ban hunting/sniper rifles?

Bill would cancel ban on gun used in self-defense

School Locked Down After Gun Spotted

Good Bye Guns

Hate crime: Tosic, family victims of anti-semitism in Lower Lake

Okay, I confess! I lied about Skinner

Can the Admins give me some advice as to religious topics?

Why was my thread locked as a dupe?

log in problems

Hey Skinner, where's the Bush Clock

Question about self-nicknaming

Question about registration at DU

Using the DU logo on my site...

For the Q1 fundraiser, could you parody Limbaugh for his Freeper DOS?

How about a room on DU for the praise of media outlets

When Will The "NEW" Rules For The GD2004 Forum..

Question on inflammatory headlines.

Well, I See I Found Where The Line Was

My thread was NOT A DUPE... Why was it locked?

I don't get the lock here

Why was this locked?

Can/Should Kerry Supporters Fight Back?

... and when the target is reached, he explodes like the Taiwanese whale..

dupe

Video of bombing aftermath

Pas, Shvu get 15-month sentence for weapons-related crimes

Bus bombing slaughters at least ten

Aspiration, not desperation

10 dead in bus bombing

Swap today; Hezbollah TV shows Tennenbaum

Mofaz decides against renewing closure on territories

Amnesty Int'l: The killing of civilians must stop

No plans to target Arafat

Prisoner swap gives Palestinians joy

Indiscriminate killing

With U.S. Help, Israel May Boost Missile Production

Aspiration, not desperation

PM aide: Blast proves need for fence; PA condemns bombing

U.S. calls on Qureia to take steps to dismantle terrorist infrastructure

The BBC's hatred for Israel

Suicide bomber's family is proud

Ha'aretz (Thurs): Nasrallah says Israel will regret not releasing Kuntar

Israelis better at manipulating media

The hour before dawn

On Sweden, Israel, art, and assassination - yellowtimes.org

If it's against Jewish law, then why is Israel doing it?

Israel may ask NASA to send Israeli to moon

Telling left from right - Ha'aretz magazine

Suicide attack on Jerusalem bus

Parents of activist killed in refugee camp criticize inquiry

Flight 11 on 9-11 - anyone have info on pilot turning on talkback switch

MIHOP! WTC # 7 was "pulled" down intentionally says WTC owner!!

Some German News

Candidates coming to Maine

Edwards needs to follow - up to January speech

The fox and the scorpion

So Sorry, voters, but you're fired

Bush says Never said IRAQ was "IMMINENT THREAT"-&media doesn't say mislead

Taliban Claim Responsibility For NATO Attack

Two Thousand Ulamas Issue Fatawa Against The Karzai Regime

With All This WMD Mess One Thing Is Clear. For Crying Out LOUD

An open letter to Senator Kerry..

Bremmer as sec of state and Powell

Blitzer / Kay "Interview"

Cheney on Russert: WORD SCRAMBLE

Assault charges against GOPerator Bob Novak...

Woolsey wins the whopper-of-the-day award

Hope to get some help on link to Counter Punch...

Do You Know Anyone Who Went to Jail during Viet Nam????

Whatever happened to former Senator Edward Brooke?

WH Wants Final Say On Releasing Emergency Declarations To Public

9/11 Commission issue is a gift that has been handed to us . . .

Bush's latest verbal blunder

Firms Support Revisions In Overtime Exemptions

Another right wing claim about Clinton, what's the whole story?

Who will pay for the Iraq war?

Are democrats more responsible for insane divorce settlement laws?

Bin Laden in custody by Christmas

Welcome to the wonderful Bush economic "recovery". AP news alert.

Is Bush* Above the Law during a 'time of war'? Republicans say Yes!

Republican accuses Common Cause of being extension of Democrats

The truth, the whole truth, and nothing but

About the Dean scream

I am so proud to see this article in my local newspaper

If Kerry wins the nomination, who would you like to see in VP slot?

Someone on Malloy made a great point about WMD intelligence

statement from CBS on move-on ad

Don Imus has

Whatever happened to the anti-trust laws?

Truth catching up to Bush (Excellent read)

The Death of David Kelly

Proof Economy is in the crapper; ALL the toy stores are taking a BIG crap.

So, who can help me refute this?

If an ET Space Craft were to land and establish peaceful relationships

Drudge taking kick backs from Botox pharma corp?

Democratic ex-mayor Koch of

Media Whores OnLine down since early Wednesday Morning.

Republicans showing evidence of support from non-whites

Why don't Dems reach out to Conservatives more often?

How long before the military runs through the 87 billion?

Wanna see a freeper cry? Mention National Endowment for the Arts.

300 Iraqi police killed since May!

Remember the "Clinton was the first President pardoned . . ."?

About 2 Million to Use Up Jobless Benefits

is this true..in SC republicans can vote democratic in this dem primary?

9-11 Commission on C-SPAN now

George McGovern>>> Still contributing.

paulthompson 9/11 timeline is gone? was it moved?

How redundant are the terms DLC and superdelegate?

DU this poll!

Duct Tape: Good For Pipes, Better for Nukes

9-11 Hearings would be impeachment hearings if a Dem had been in charge

Vote at CNN.com now!

342,000 people filed first time unemployment claims last WEEK

OK check in on ABB

Man charged with smuggling nuclear triggers to Pakistan ordered released

Spectator (UK): Hutton Whitewashes Blair

Will Bush Fool the People Twice?

Michael Jackson, Jesus Juice and Teenage Boys' - by Ex-Adviser

"41" was having breakfast with BinLaden's brother on 9-11 in White House

Thom Hartman on, Talking about the Fed. Reserve- Bush

Outraged with the Blair Deceptions!

05-2003 poll: "Housing a higher priority than tax cuts"? Yes!

ALERT: I hear Kevin Phillips is on NPR's FRESH AIR...

Separated at Birth??

Kobe's wife about to get another big rock

More "economic recovery" news

Kevin Plillips coming up on NPR.

I feel sorry for Martha Stewart

Ashcroft: Bush would veto bill scaling back Patriot Act

what are the average ages of

Trying to find video link. Help.

The fundamental difference between cons and libs on foreign policy...

The original CNN poll got changed--Vote on this one about WMD

The reason why Bush knows for sure

Military in violation of Congressional approval?

CSPAN>>> RNC winter meeting 1:30 pm eastern

How to be a Republican

Does Bush have an opinion on WMD's??? Isn't he outraged???... naw

New Bush ads

Maureen Dowd: Way Off-Base about CIA?

Toll free Capitol Hill Switchboard Number 1 (800) 839 - 5276

Proof - Get rid of Bush Tax Cuts = end of deficits

Congress violated the Constitution by giving Bush the power to invade Iraq

7 GI's killed in Afghanistan today.....news to come

If Bush cheats again in 2004 will the asterisk be appended?

did commodity traders know about mad cow first?

* admin 'pressure' on CIA, etc. isn't the point

Pelosi rips GOP lawmaker on job offer

America as a One Party State

list of intelligence agencies/dates telling bush*: "NO WMD in Iraq (link)

why would any woman vote for a man who

"You, sir/madam, are a LIAR"

No...O'Reilly caught in another LIE???

Ways in which American "capitalists" oppose it when it violates interests.

MIHOP! WTC # 7 was "pulled" down intentionally says WTC owner!!

Japan is paying Iraqis to protect their troops in Iraq (for real)

"I am a Dem who voted Gore 2K and will vote Bush 2004?"

NH citizen gets under Novakula's skin....

When is bush* going to do something, catch someone to divert

a local repuke has been attacking Democrats in editorials for far to long

Frank Gaffney is Perle's tool and a PNAC signatory

Black & Decker will announce later today they are closing two plants

Voter passion and turnout--Favors us?

Socialist Equality Party announces US presidential campaign

CBS' censorship of MoveOn ad; Some Reps wade into the fray

I had to e-mail my Senator today....

It seems to me that I hear FEAR in Republicans who speak about Kerry

Whatever happened to the missing helicopter pilot(s) and soldier(s)?

Another case of superb parenting...

Here is a chance to vote your conscience. Go on, it's good.

Joe Conason on CNN Now

Will US and Britain ever be held accountable...

Guess How the Grocery Strike in CA is Gonna End?

GWB on CNN Politics now

My GOTV results from last night

Anybody ever see these?

Yesterday for the first time I saw the "PANTS ON FIRE MOBILE"

500+ boots in Chicago - 500+ crosses on the beach in Santa Barbara

Stumbled on this - I love scared conservatives - they're so cute!

dupe

Blessed are the home health aides, for they shall save our economy

Young inmates caged, drugged, state study finds

How about a room on DU for the praise of media outlets

Sweet Tea Democrats is Back Online

The State of the Union Drinking Game -- Now Available for SOTU Reruns

Karl Rove opened his mouth

Japan paying Irakis protection money?

I love it when a Repuke says "Anybody but Bush"

Our soldiers are not "fighting" in Iraq...

Flight 11 on 9-11 - anyone have info on pilot turning on talkback switch

Perle on "The Daily Show"

Arguments for War Exposed

Matt Lauer's Interview of Condi re: WMD

Richard Schmidt letter: President Bush an honorable man

Why can't I recall my Governor? - Rowland And The G. Fox Deal

Need help with facts

Sen. Lindsey Graham "Minuteman of the Year"

Coincidences. Confessions of a Tinfoil Hatter.

The Hamster gives us the truth about the Al Franken incident

Is "Dr." David Kay a scientist? Ask one who IS.

U.S. Military 'Sure' of Catching Bin Laden This Year

Why stop with electability?

Has George W. Bush visited Saddam Hussein?

Skull and Bones

After all the crap Clark got for promising no new attacks...

can someone supply an update on the BCCI trial??

Where's Ethel???

The Dead Center.........by Robt Reich

So.....are the DLC "Establishment for Kerry?" and if so, does anyone hav

More Pain for the Unemployed-CBS

Next time a Conservative calls Liberals perverts...

Anyone watch Lou Dobbs tonight?

Rice: we may never know about WMD's because of looting....

Brokow

OMG. Dennis Kucinich just mentioned PNAC during the live debate!

Cannabis downgraded in the UK TODAY !! Hip Hip Hooray!

What's up with the Reagan dime?

Is anyone else having trouble connecting to The Smirking Chimp?

Why I would discourage Republicans from voting for a Democrat for Pres

I refuse to tolerate "Tax and Spend Liberal"

"Bush in denial" NY Times editorial

Dumping Cheney?

I need Bush went AWOL links

Condoleeza Rice: Saddam defied world by not admitting to non-existent wmd

So Let Me Get This Straight. You Impeach A President For A Lie About

Silly me, I thought Rice was talking about Bush...

A great idea for all of us

Why should I be against school vouchers.

Local CBS affiliate does "Reality Check" on Super Bowl ads

Mike Bloomberg Plans Snub-ya to Dub-ya

Link to your favorite freeper-related threads

BBV: on All Things Considered

Libertarian's outraged list of W's big-govt spending--good reference

Paging Mr Soros.. Paging Mr Soros

Anybody know whether David Kay is a PNAC member?

Iraq war contracts handed out two years ago!

Wow! CBS News does Soldier Suicides story.... (real news)

Has Bin Laden been captured?

Hey, Perle, we want to see that letter you have

OSP, CIA , and the big bad intel...

Why Clinton didn't send troops to Iraq...?

What 's the first scandal the newly elected Dem president faces?

Miss Norville was fierce just now!

martin short on Dennis Miller panel????

BBC apologizes to Blair--poll to DU

Preemptive attack on the moon

Ritter was right.

A sure sign the apocalypse is coming

D'oh! Colin Powell denies WMD in 2001

Aaron Brown discussing 9-11 extension on CNN now

Does this sound like deja vu all over again?q

Carville makes Tucker's voice 4 octaves higher. Crossfire 1/29/04

Let's not call it the Iraq war anymore, it's mis-leading.

will you repeat that statement. I'm not retarded yet.

Richard Perle on John Stewart

Editorials Question Bush's Role in 'Cooking' Up a War

There goes Dennis Miller Again....

Jason Chappell , aged 22

Colin Quinn is a total Moron

Is it just my imagination or has anyone else noticed this?

Sadaam Bluffed?

I finally finished "The Price of Loyalty"

Another deportation at the hands of a cruel and callous INS

U.S. Military Sure of Catching Bin Laden this year

Are Unions special interest groups?

David Kay Says "We were all wrong"! Commentary

Jeff Greenfield: Al Gore used Willie Horton on Dukakis

students of 'merican history help me out

Haven't seen too many "Bush/Cheney" bumper stickers lately

Should the sale of diamonds be outlawed?

Everything Changed Last Night - It's Over

W's Facial Abrasions

For the historians - how will the Bush dynasty end?

Why did Bush let Kay testify?

Leaders from Hell. We all know a few from the past and how their

Does the US envision democratic Iraq with an electoral college?

Even if Bush did produce Bin Laden in October....

Hey, British DUers! A few questions...

What's The Mood in The White House? Nervousness? Panic? Blind Arrogance?

Day of Remembrance for Space Explorers Lost

O'Reilly owes America an apology--and you can help!

Camejo to debate Solomon Sacramento today on KPFA democrats should listen

Google ad title "The Left Hates America" - don't they ban anti-Bush ads?

BBV: please write NY Times and mention "The Voter Confidence Act"

Which term best describes the Bush family:

MUST READ! Foreign Grad Students and the Silver Ring Thing (HHS supported)

Conversation with Military Readiness Group : stepson, Iraq

Randi Rhodes - send Congress a message about 9-11 commission

MoveOn is all over Peter Jennings and Bush's military record. Here is

Did Putin just take back a Peak Oilfield from exxonmobil?

For your UTER sickness...Jerry Falwell on IS GOD EVER PRO-WAR

Hannity on WABC in NY

I admit it... I don't quite get the patriot act.

A thought about the WMD...

jon stewart DECIMATES condi

Research Challenge (Lexus/Nexis anybody?)

ABCNews breaks story about Iraq War opponents being bought by Saddam

If Bush Was Convicted Of Murder (a piece, by me--read it!)

Illinois DUers...what do you know of our Senate candidates?

Republican message boards to go to and laugh at?

Proof that not all freepers are brainless

That pathetic Alan Colmes

MOYERS: Big Media's backroom deals; How Dems are losing the South

Have you ever met a confederate sympathizer?

"I'm A Republican and I Won't Be Voting For Bush"

It's Not Drip Drip Anymore- I hear water running.

Is anyone else amazed that an extra $18 m to the Arts gets so much press?

Bush: "There's excitement in our economy!"

Predictions for: "We've Got Osama" Date

Freeper vs. Freeper

how much is a decent teacher worth to you?

Dean on Hardball mentioned cooked NIE...

"The Guy James Show " need your expertise on the abortion issue

Making much of marriage

Civil War Possible In Iraq

Nigeria says N. Korea agrees to share missile technology

San Jose Mayor Ron Gonzalez just had a stroke (TV news only - no link yet)

Dean to visit campus today

NH citizen gets under Novakula's skin....

US Army May Keep Forces in Iraq Through '06

Bush* Scaling Back Dollars for Third World

Exxon is ordered to pay $6.75 billion, but few expect money soon

Ex-Arms Monitor Urges an Inquiry on Iraqi Threat

FCC to hear about public interest at San Antonio hearing

MyDoom Sequel Has A Twist

New Hampshire Exit Polls Present Warning Signs for President Bush*

Japanese top official maintains Iraq has WMD

BBC Director General Greg Dyke resigns

GOP Goose is Cooked: Democrats land haymaker as Bush babbles on

At least 10 dead in Jerusalem suicide bombing

Suicide Bombing on Jerusalem Bus, Casualties Reported

Arab, Israeli Prisoners Leave for Germany

James Brown Arrested on Domestic Violence

Roadside bomb in central Iraq city wounds five civilians; large Shiite pro

Stronach might have conflict, rivals say (Cdn Tory leadership) - T.O. Star

U.S. planning al Qaeda offensive in Pakistan

Safety of Americans Less Important than Politics

Bush Preps for Possible Run Vs. Kerry

Bush Is Said to Seek More Money for Arts

Blast hits Iraqi Security Forces (1/29 0118)

Kay Admission Fuels WMD Political Fight

Protest staged over KMT assets

Higher Prices, Tax Gain Lift Exxon Mobil (Thanks George)

Gay Men Lose Challenge to Florida Gay Adoption Ban

Former Iraqi Officers Angered by Police Crackdown

Morocco: Police break up anti-US demo

Bomb kills British soldier in Kabul

Charlotte Observer:Democrats have more testing to do

Two Vancouver police officers fired over assaults

CBS Defends Scrubbing Anti-Bush Super Bowl Ad (despite objections)

Area dairy farmers fear the fallout from scandal

The following is a transcript from Senator Durbin's speech on the Senate f

About 2 Million to Use Up Jobless Benefits

Rallies for Ku Klux Klan, Democrats planned here same day

Pelosi rips GOP lawmaker on job offer

DEP chief will join company he helped

U.S. general: Capture is 'strong proof' al Qaeda in Iraq

Blair's Vindication Provokes Media Backlash

Jobless claims flat

Senate Passes Pension Relief Bill (Defunds Pensions By $96 Billion)

Pakistan Bans Anti-al-Qaida Operations

Ottawa promises inquiry will get to the bottom of Arar case

Blix: Diplomacy forced Libya to give up WMD

Iraqi officials probe 'illegal jail'

Doctors question Kelly 'suicide'

Mars Spirit Rover update (January 29) Back at work early next week!

Ashcroft: Bush Would Veto Bill Scaling Back Patriot Act

A Drug Used For Cattle is Said to be Killing Vultures

Soros prepared to dig deep to oust Bush

bbv on all things considered

$161-million CSL 'error' puts Martin on hot seat (Cdn PM) - Globe and Mail

Chirac sold out to PRC for commerce, says Lu Taiwan VP

7 U.S. troops killed in Afghanistan

13-year-old boy released from Camp X-Ray

Bush Budget Raises Cost of Medicare (From 400 bil to 540 bil)

U.S. military 'sure' of catching bin Laden this year

Bush Seeks to Deflect Calls for New Iraq Inquiry

Berlusconi needs more than cosmetic surgery

STOCK MARKET WATCH, Thursday 29 January (#1)

Iraqi Minister: Bribes by Saddam Routine

Inmate executed; in last words, he claims part in other killings

White House to Project Deficit of $521 billion in 2004

U.S. general: Capture is 'strong proof' al Qaeda in Iraq - Link

Topeka Company's Closing To Leave 790 Out Of Work

Blix dismisses Bush claim that Iraq war forced Libya to give up WMD

Turkey PM: U.S. Should Stay in Iraq

Five Saudi Agents Killed in Shootout

More head injuries in Afghanistan, Iraq push improvements in protective ge

Sudanese jets bomb Chad side of border town, killing civilians

Workers' Wages, Benefits Tick Up 0.7 Pct. (WE'RE RICH!!!)

Venezuela Reports Clash with Armed Colombian Group

Afghan weapons cache explosion kills seven U.S. soldiers, injures three

MIKE PLANS SNUB-YA TO DUBYA

AP: U.S. in No Rush to Privatize Iraq Oil

Demands grow for inquiry into the case for war as Hutton is accused ....

Dean Skips Airing Ads in 7 Primary States

Thar she blows! Dead whale explodes (MSNBC)

Campaign Ads With Bush Count As Donation

INCREASING PROBLEM: Swedes have more and more animal sex

Iraq Minister Says Saddam's WMD Carefully Hidden

Rice rejects outside probe of Iraq intel ("current reviews sufficient")

Washington Mutual plans layoffs in Cobb (Georgia)

GOP may not help Majette in re-election bid

Iraq Commission Could Pose Serious Threat to Bush

'CtrlAltDelete' Inventor Restarts Career

U.S. has quietly expelled dozens of Saudi diplomats

Bush Budget Raises Cost of Medicare (drug bill cost up 33% over

Youngest Guantanamo inmates freed

Powell Assures Turkey on Kurdish Issue

Navy Commander in 1968 Spy Ship Case Dies

Poland to become oil gatekeeper thanks to Odessa-Gdańsk pipeline

US judge clears bail for Israeli accused of nuke exports to Pakistan

10,000 Said Driven From Congo Diamond Zone

Military stint may cost Boeing workers overtime

SF Chron: Clinton and Senate Democrats meet on agenda

U.S. Acknowledges Some Flaws on Iraq Intelligence

WP: Dean Staff Shake-Up Long Coming

Ford to lay off 1,000 workers at St. Louis-area plant

US admits flaws in Iraq intelligence

Debate Over Iraqi Arms Poses Risk to President

US Justice Ginsberg Warns Of Apathy Over Civil Rights

Rampant E-Mail Virus Traced to Russia

Job Market Sends Mixed Signals

High Suicide Rate For Iraq War GIs

Exxon Mobil Corp. set record profit in 2003: $21.51 billion US

Companies Suppress Antidepressant Data

Florida Court Upholds Ban on Same-Sex Adoptions

Republicans Warn Bush Budget Won't Cut Deficit | Reuters

KB Toys chain says it will cut 3,500 jobs and close at least 375 stores

Bush Seeks Increase in Arts Funding

Supreme Court won't issue stay in Colorado redistricting fight

'93 Tender Won by Exxon Annulled

BBV: Security Poor in Electronic Voting Machines, Study Warns

N. Korea Ups Stakes With Missile Peddling

U.S. Releases Juvenile Prisoners from Guantanamo Bay

Contractors may write own nuclear site rules

Georgia Senate Votes for Zell Miller Statue

U.S. Man Hits Brazil Baby With Water

IBM cutting 300 jobs in systems group

Guardian Utd (Friday): New poll reveals public mistrust (in Blair)

US big shots back outsourcing

U.S. Military 'Sure' to Catch Bin Laden

Sears call hub closing; 800 jobs cut off (by CitiGroup)

Michael Moore prepares provocative 9-11 project (AP)

Vatican condemns AIDS drug firms

Venezuela Says Foes Bribing Cuban Doctors to Defect

New Poll Reveals Parents Favor Abstinence Education

Georgia May Shun "Evolution" in Schools

Candidates on the issues: Cuba

Begs someone to make this poll

Commercials

The South Pole is warmer than North Dakota.

Why do you guys pick on Robb?

Young picture of Dean

When Trumpets Fade

OK Look. I Want A Democrat President So Bad That I Would Walk From

LMAO, I'm reading only Tom Tommorows

I just dug my car out of two feet of snow. Ask me anything.

I'm Drinking a Bottle of '97 Cakebread Cellars Benchland Select Cab

the U.S. Emperor... Emperor Norton 1, a history lesson...

Hamm Supporters ---Please Check in---

Anyone Like French Bulldogs?

I just bought an FM transmitter!!

"The Giant Sucking Sound"`

Today In Twisted History (3/4 Bush*-related!)

Clinton sent only 2 e-mails as Prez

James Brown's latest mug shot on "Smoking Gun"

Elroy "Crazy Legs" Hirsch passes

The smallest PC in the known universe?

Favorite drink?

Pick your favorite Bush!

Good Morning from North Bay Ontario - Brrrrrrr -22 Celsius

The World is a safer place: Judge orders R.Kelly to avoid M.Jackson

OK. John Edwards. Sam Neill in Omen III - ever see them together?

CONFESS!!!!!!!!!! Who let the dogs out???

Spelling mistakes & E-Bay...buyers paradise?

holy chit - it's 49 degrees in St Pete, FL this morning!

Hedonistic Head Stone Planned For Lottery Winner

Fake boyfriends/girlfriends booming on eBay,

No More Public Urination For Minnesotans

Favorite ROMAN number

Calling all Columbus GA Democrats!

Who is your fave male singer?

Does this look like an old man who knocked wife to the floor? or sings for

Anyone ever go to Hot or Not.com?

Wow...I just had someone do something VERY nice for me...

I told off the local Repug Rush WannaBe! Ask me anything!

Right Wing critique of Chomsky

OMG! James Brown being held by.........MIKE HUNT!!!!

How do you pronounce "grocery"?

It's 3:45AM...why am I awake???

Favorite SUPERTRAMP number

It's f*cking 55 above here....

Freeper wet dream

Sometimes cops are devilishly creative...

A short story that I hesitated to post....

Smart ass comment on lost moderator warnings

Favorite 10,000 MANIACS number

Any last minute suggestions about my insurance policies I'm about to get?

Disgruntled Customer Releases Deadly Snakes in Bank

It's f*cking 30 below here....

New Flash Animation: Saddam Hussein.

Hahaha.. The Dis-Associated Press .. too funny

Sorry: Wrong forum!

Question regarding books on puberty

Ceremony honoring return of soldier'sbody - live now on CBC (10:30am)

Word games from 2003 - WP 2003 style section winners - new 2004 is now!

And you thought YOU had a bad day at work?

Vegetarians/Vegans and anyone wanting to try something different...

Clean the ice off your freaking car, you lazy asshole!

Another guy who had a bad day.

For You DUers!

Is your date just a little to ugly? Solution right here LOOK!

Why isn't my pop-up blocker working? This is the third time that Bush

You just never know.. Live EVERY minute..

Any fans of "The Critic" here?

Daddy Brag: My Daughter's First Parody!

Superfly has passed away...

Did any one hear ever attend Savannah College of Art/Design?

That's IT.. I'm taking a break.. Entertain me

Who will be your Father Figure (put your tiny hand in mine...)

Crop circles on Mars?

BRIEFLY STATES LANDS CATWOMAN LOUNGEWEAR LICENSE

Guess Who this is: What famous person died on this day in 1977

TV Trivia

Ughhhhh...I have to have a colonoscopy

Help! I need a link to an article from earlier this week

Anyone have a favorite online mortgage place?

A shameless but worthwhile plug for George Harrison

I have been Cable & TV free for 3 weeks now....ask me anything

Antipodean DUers: Remind us of what summer is like!

The Flying Bushito Banditos

This sunshine DAY after DAY after DAY after DAY is just RELENTLESS.

What is it with some new college grads???? semi-rant

Fun game to play while snowed in for 5 days

Chicago loses a landmark....

Test

Some ideas for new avatars

CAPTIONS can help to shield your eyes from the awful truth....'kay?

Marriage, Part 1/2/3 and 4.... for all the married women here at DU

Some kid's website, MikeHuntSoft.com, being sued by porn company

Help! My feet have been cold (no, freezing) for 6 weeks now.

F*ck all y'all... I'm from Texas!

Super Troopers quoting thread...

Two boys are suspended for bringing tiny GI Joe guns to school...

Uncle Richardo's Review: Zellweger saves "Cold Mountain" (no spoilers)

Um Gott es willen!

How is Vancouver this time of year?

Mustard Guy for President

neighbor's barking dogs...what to do?

I'm not at work(school) because I am sick. Ask me anything!

Ya know how the repiggies love that crybaby graphic?? Here's one for them

this cute girl sitting next to me in the Pc lab is talking to herself

Why Does My Picture Only Show In My Posts Half Of The Time?

This is why jobs are being sent over seas.

Default Block Network Trojan Horse

Memes you'd like to see

In a road rally from Agusta, Maine to San Diego, California, Who'd win?

Statue of Yoda worth $20,000 is stolen

Caption this photo of Saddam...

You bluegrass musicians on acid will LOVE this....

Austin DUers...dinner before BBV meeting tonight (1/29)

Does anyone remember "Brew 102?"

I will write in Hamm before I vote matcom

I've just discovered some great pre-prepared food

I had a dream...

Cats

My 300th post is coming, ask me anything!

Corporate mergers on the rise

Ivan Rodriguez on the verge of agreement with Detroit Tigers

hahaha...Remember this J-Lo blowjob incident on Faux?

Stupid videos

I'm happy about 2 votes for GWB--here's why:

Robert Rodriguez to do "John Carter of Mars"?

How many times are they gonna show the monkey riding the dog??

What do you call a Boer who's not racist?

Who knows anything about digital pianos?

Anyone see Colin QUinn on Leno w/ The Queer Eye guys?

Virtual jigsaw puzzles

what are the average ages of

Cast Set For "Hitchhiker's Guide To The Galaxy"

Do You Think Les Moonves Had Everything To Do With Killing The

Childhood crushes today? I had a huge crush on Terri Nunn of "Berlin" as a

Missing tortoise update: Rosebud has been found!

The art of war

Dangers of being pedestrian

My cat is blackmailing me

ULTIMATE Poll: HOW MANY Stairs Has Matcom's Ass Climed Over The Years???

Help with an unruly boy! (please help)

Rick Berman possibly out of Star Trek? (rumor)

Please help me celebrate my 300th post!!!!

Why am I DUing when I need to study Genus names for trees?

Court Says Cop Wrongly Fired For Masturbation Video

TTTTTAAAAAAAGGGGGGGG!!!!!!!!!

Mmmmm Big Mac....

new Hannity advertiser AAA

Philly Gathering Update!!!!

For those dealing with parent care.

From ATA: A request for what would be the world's smallest forum on DU

Exploding whales!!!

My fellow cannabist, please explain this small point

Victor Petrenko Charged with Driving Drunk

Randi Rhoads just smacked a Bush-supporter on the radio.

Here's a fun little "retro" site

Wanna see Mobius strip?

LOOKING FOR SYMPATHY!

Can't we all just get a bong

97X Bam! The future of Rock and Roll is sold

Can't we all just get a gong?

Deans dad can beat Kerrys dad!

Film theme time!

Did anyone have trouble in High School?

Can't we all just Ballrooms of Mars?

Rumor for us nerds... XBox to be reduced to $99, Xbox 2 in 2005

Famous Dingbats in History: A Pictorial Tour

You must go and see this...

HAPPY BIRTHDAY CURSE10!!

Can't we all just bang a gong*?

FINALLY DONE WITH MIDTERMS!!!!

Damn.. Christmas is over, and I missed this ..

I may hold the record for the shortest Skull N Bones thread ever!

Can't we all just watch King Kong?

I had retinal laser surgery this morning . . . thanks DU Lounge

Can't we all just Sing A Song?

$10 = 3/8th of a tank of gasoline

GD 2004 Primary - "Where An Intelligent Consumer Is Our Best Customer"

Crotchless thongs

My wife tried to poison me last night...

perplexed in New Hampshire CAPTION

Anyone know a good website to purchase progressive themed flags?

QUESTION: When Clipping A Cat's Nails...

A Visit To The Rodeo . ..

Found in the Newly Opened Archives

Can't we all just smoke a bong?

Can't we all just Cheech & Chong?

Can't we gays just thing another thong?

The annoying "General primary forum" warning.

Can't we all just Wang Chung?

Daily Show's Steve Carrell in U.S. Remake of the Office????

Can't we all just wear a thong?

Anybody else starting to get cabin fever?

OOWWWW!!!!!! @$#@^$#!

Tonight's selection: "Live Rust"

Never hold your farts in.

Thar she blows! Dead whale explodes (MSNBC)

"Hon-da Solo", or "May the Del Sol be with you"

Thomas Paine born January 29, 1737

Can't we all just watch Long Dong (Silver)?

Close calls..yours or your kids..

60-Tonne Decomposing Whale Explodes On Taiwan Street - Many Injured

The weather outside is DEADLY right now.

My conversation with a "Libertarian" friend a few days ago:

Play the piano ONLINE.. you can even record and play back..funnnnn

Candy Crowley just predicted a "major load"

Insomniacs check in! I've got some bad news!

Can't we all just smoke a long King Kong bong, singing a song, in a thong?

Is "Eskimo" a racial slur?

Cold? Wadzdat?

Someone PM me!

4 days OFFline in a snowstorm, 300 dollars later

Kerry: The new Botox spokesperson

signs your football team had a really rough season

Who used to jump up and down on the ding ding thing

Can't we all just get along *cries*

That crazy Aussie is at it again!

Time is on my side, yes it is...

Can't we all just bang a gong??

Debate Transcript ?

Digital camera tips & some really nice pics

Anyone have TiVo? Love it? Use it to watch tonite's debate?

PACKRATS! What are the strangest things you save?

Favorite multiplayer online games?

i had to change my avatar

A Daily Dose of Imagery----Toronto lovers will enjoy this one

Seattle update

Does anyone else get a kick out of those Enzyte commercials?

Fellow househunters! We need your collected wisdom.

I am getting SPAMMED with dozens of emails to increase penis size

Why do the villains only sweat in hot areas in film?

Lounge goers room for another ?

Mensan DUers check in!

I saw "Shattered Glass" tonight --

Favorite Raspberries song?

Americans: who is your favourite Canadian Prime Minister?

I've Forgotten How Much I Love Cronenberg's version of "Naked Lunch"

Moulin Rouge soundtrack for Dem Election win?

more reason to boycott the Super bowl

Hey Truckers!! I have a question

I just got mail from William Rivers Pitt!

Cats in BIKINIS! Hot!

Am I a pervert? I think "The L Word" is one of the greatest shows ever!!!

Do you watch TV news?

Who's right, me or Mrs. Robb?

Colin Quinn is a total Moron

A possible job idea for the unemployed

Has anyone read John Le Carre's apparent about-face novel?

Who would win in a fight?

chat tonite

OhmygawdOhmygawdOhmygawdOhmygawd...

I am getting SPAMMED with dozens of emails to decrease penis size

Were you breast fed as a baby?

Please request Incubus anti-Bush/war video on MTV- link

I qualify for work in New Zealand!

James Brown - worst celebrity mug shot?

What movie can't friends believe YOU like?

That 13 year old kid from Whale Rider got an Oscar nomination????

IDEAS NEEDED: What Do You Do For Fun?

If you want to eat INSANELY TOO MUCH of something, see that it is sushi.

DU Chefs: What's the best nonstick pan on earth?

Rumbles we'd like to see... pick your favourite

Good lord, I just now found out Kirsty MacColl is dead.

What classic/popular book have you somehow never read?

QUESTION: When Clipping A Dog's Nails...

Ronnie James Dio for President!!!!!

Have you or someone you know been on Judge judy, peoples court.etc..?

I lost my winter gloves can someone help me find them

Holy Crap! Anybody catch CSI tonight?

Anybody seen the ProfessorGAC lately?

Oh my God! They Banned Underpants!! You BASTARDS!!

Pat Oliphant for your viewing pleasure

What song makes you turn the radio up every time?

Pizza

political gear for snooty aesthetes?

Nirvana fans check in!

What Song makes you change the radio station everytime it comes on ?

Problem cat. Any suggestions?

the spelling and grammar nitpick thread

New kitty pics!

I'm Not Accusing Anyone Of DU'ing While At Work But....

INCREASING PROBLEM: Swedes have more and more animal sex

Chihuahuas: Dogs or overgrown rats?

The Anteater Thread

It's that time again...favorite Repo Man quotes

What time of your life would you love to go back to right now?

Need picnic table plans

Stupid military question - what is an RPG?

DU Rumbles you'd like to see

so what states have you visited?

NY'ers - Anyone been to see Hugh Jackman

Artists and Artistic types in NY and New England Area: This weekend

Where's Ethel???

what are the ratings of Dennis Miller's new show?

Is Long John Silver any good?

Poll - Blasters, Stray Cats, or ShaNaNa?

Navy now limits access to DU!

Rock or Rap or Hip Hop or Jazz or Blues or ..................

**********MILESTONES**********

Condom use

..oops

Why are so many DU Kerry supporters STILL attacking Dean ?

Were Dean's Trippi-produced ads really that bad?

Where did Dean's $40 million go? - good extensive Dan Conley post

This is "Democracy"...2 States down and the "Media" crowns Kerry???

Which was the nastiest primary season ever?

A Windsurfer in the White House?

Debate today?

The Dean Ads

Dean, Trippi and Paid Media

Yankee Kerry is on a roll, but the South awaits

Why am I starting to feel disgusted and bad about this year's election?

I KNEW IT!!!! From a totally ticked off Dean supporter and contributer!

Detroit Free Press: Kerry, to Win

Ralph Nader may be getting closer to joining the race tonight.

Kerry Keeps Overcoming

Clark's money situation

Campaign Manager in Spotlight as Kerry Becomes Frontrunner

Howard Dean car alarm goes on market

Young picture of Dean

Going door to door for Dean this week - does anyone have a better flyer?

The upside and downside of running several candidates for President

Clark People: Bill Maher Stood up for Wes on Larry King!

Mayonnaise Supporters ---Please Check in---

Winner Drew Strength From Study of Weaknesses

Hamm Supporters ---Please Check in---

How do you think Al Gore is feeling tonight?

Thank god, Dean is getting a new campaign manager!

Honest Question: How can we trust Dean to balance the budget

An open letter to Senator Kerry..

Make Your Voice Heard NOW, Before Feb. 3rd!!

Assault charges against GOPerator Bob Novak...

Kerry mortgage house for campaign-ok; Arnold borrow money for campaign

Was Trippi Moved out because he Dissed Gore? Gore was needed in NH!

I will write in Howard Dean before I vote for Kerry

Clean/Dark

Clark is coming to Houston Feb 11th. Houston Clarkies, PM me for info

McAuliffe Wins Big in Iowa, NH

What are Kerry's skeletons in the closet?

NYPost--'Clintons Seek To Right Dem Ship'

Is Kerry the only liberal Skull and Bones member?

TN: Kerry has longtime supporters here

Weird... Public Enemy #1, Joe Trippi, bilked 10's of thousands of millions

Candidates on Tonight Show : baby-kiss test...uh oh, Dean

Forget the south... for just a second.

I just finished my 200th letter to primary states for Edwards

Bill Mahr on CNN: Shrub was AWOL Attn Kerry & Clark people

Great cartoon about the media

Dean may go on, but the campaign is effectively over...

Yesss! A new candidate!

How useful are endorsements?

Why didn't Dean shake up his campaign before IA?

CNN: All African-American voters should vote as does South Carolina

Dropping out of public financing

What do Kerry/ Dukuakas (sp) have in common? They both come across as

Is it true Teresa Heinz Kerry can . . .

Dean asks staff to defer paychecks for two weeks

CALL IN CSPAN>>> the media coverage of the dems!! 8:41 am est

Arizona Republic endorses Lieberman?

Dean supporters to flock to Clark?

PBS bias

Edwards Says South Carolina A Must-Win State

Hey Wes: Dump Chris, Get Joe!

Baiting among attorneys at my law firm. Sheesh.

How much money did Joe Trippi make?

CBS News: John Kerry's Contradictions

Why does DU look more like Free Republic tonight?

"Frontrunner scrutiny" is another way of saying media "hit list.." .

Dean fundraising

Wonderful Huffington piece on Judy Dean -- my 1000th post - Yippie

Great turnout for Edwards event in MO:

Data from New Hampshire does not bode well for Chimpy

Remember how dead Kerry's campaign was last November?

The media - Dean's "scream" = Gore's "sighing?"

isn't it ironic? gore/dean

Post-Feb. 3 Primary States: What will the ballot look like?

CSPAN CALL IN>>>> 9/11 comission 9:43 am

The implosion of the Dean campaign

Dean supporters only, who would you support if Dean drops out?

"You Say Deserter, I Say More Dessert..." by Michael Moore

'Chaos' hits Dean's camp

Dean team - take a look at Delegate Set-up - March 2nd will be the key

If Dean doesn't win on 2/3 is it over for him?

Clark Supporters....Do you know where Clark is campaigning today?

I kinda thought Joe Trippi was the man...

Dean supporters. Is it Dean or nobody else?

There has never been anyone like Bush in 200+ years of American government

Party Leaders Express Relief at the Emergence of DLCer Kerry

I think the Kerry campaign used a classic "rope a dope" strategy to win

Either Dean or Clark can still win big

Kerry and Bush have Iraq problems

What time, channel is debate today?

We are not Dittoheads

Dean may lose, but what he's unleashed in us will live on

Bush, Kerry Both Have Iraq Problems

I'd like to thank everybody who responded to my Clark post the other day

That's it, I'm saying it: if Dean does not win I'm voting for Bush.

Should Clark focus resources on just 2 states to insure at least one win?

Delegate Count as of Wednesday, Jan. 28th

What would the Dean campaign have to do in order to get your vote?

Drudge: Kerry's "Before" and "After" Pix

Why the right-wing is afraid of Kerry (CAUTION: right-wing source)

Dean Team - Call CNN - alert them to ABC disclosure on Iowa Scream

Collecting Delegates (a service of this link!)

Is Bush terrified of John Edwards?

Did Kerry "smear" Dean with "Osama Attack Ad" 12/17/03 ..... forget Kerry

VA: Kerry lines up local support in preparation for primary

anybody have a link that shows the upcoming state prim. / delagte count ?

My prediction for the "Final Four."- Hint: the winner is not Kerryor Dean.

Why do Dean supporters retaliate with RNC smears on Kerry's record?

Paul Begala calls me a "Conspiracy Theorist" and the Left Faction of the

Kerry Web Ad Campaign Launched By Voter Interactive

Claims that Kerry ran a Bush/South Carolina smear against Dean are false.

Enough loyalty oaths!

Discussion of Dean alternative is waaaaay premature for Dean supporters

John Edwards and John Kerry voted AGAINST Ashcroft

Once again, Dean takes the spotlight away from Edwards

Anybody But Bush check in

The anatomy of a primary

Which Pres. Candidate best suits you? How to choose

Kerry in the crosshairs (RNC speech drops anti-Dean comments)

Myths and Legends about John Kerry: True or False? A compilation!

Stand with us: Dean's remarks in East Lansing, MI

Electorally speaking...

The DEBATE tonight...When and on which Network?

Gillespie: "Kerry voted to cut intelligence budgets in the past"

Edwards and Kerry are LOADED!!!

Furthermore, about voting Democratic...

somehow, I convinced my freeper-like friend to vote for Kerry

media confessions- can we have a link???

CSPAN>>> RNC winter meeting 1:30 pm eastern

Dean to Focus on 7 States After Shake-Up (AP) (new strategy)

Apologies to Kerry/Edwards concerning Ashcroft, head in sand

had to come back and post 1971 Doonesbury

The Social Psychology of Dean's Plummet

"Knocking down Kerry now, they say...

Looking for candidate platform comparisons...

Presidential Aspirants Offer 'Pledge for the Arts'

New Clark TV ads.

Why hasn't "electability" worked more in Clark's favor?

Anyone else feel a kind of sadness today about the primaries?

Longer primary campaign may help Democrats

A comparison/analysis of each candidate's healthcare plan

God I'm sooo tired of this insider/outsider crap!

what do the Kerry supporters think of.....

New Clark ads

E-mail Gary Hart!

If Kerry wins SC on Tuesday will people stop sayin "Kerry hates the south"

Edwards Denies Botox Treatment

I'm watching Kerry's Biography on Democracy Now!

Edwards Supporters: Anyone have a link to an article on his history?

Who's dismissing the South?

Dean Skips Airing Ads in 7 Primary States

What Do You Hope To Hear The Candidates Say Tonight?

Dean's Speech, "Stand with us!"

Dear Mr Blumenthal - smearing Clark with dead issues

Edwards/Kerry/Clark/Dean donor demographics

We're complacent

How do you expect us to vote for the DLC?

American voters in Canada (and other nations)

Dean Campaign New Theme - I Hope

Latest ARG - Oklahma, Arizona, South Carolina:

The Curious Case of the Missing $40 Million, or, How To Get "Free" Media

So I saw John Edwards in person last night,

"There Is No Difference Between Gore & Bush" - Ralph Nader, October 2000

Question for people who support Al Sharpton or find him favourable...

Some possible VP picks for Kerry (Southern women)

Trippi's Gone, the $41 million's gone. Is this Howard's End?

The view from New Hampshire - John Kerry

Arizona Primary & Diebold Voting Machines

Arizona Republic endorses Joe Lieberman

Does Clark have to win at least one state Tues?

Latest SC poll results

John Kerry: War wounds

Rank the Candidates

What legislation has Kerry authored as senator

Clark supporters, check in. Any other interested people, welcome

So, let me get this right about the Dean Scream.

The view from New Hampshire - Howard Dean

This is interesting.

How Clark or Edwards can get Kerry: Say I'm electable in the South

Kerry folks meet our new endorsers in South Carolina, Missouri, Arizona

The view from New Hampshire - Wes Clark

The enemy from within.

Dean Video

New National Poll: Dean inching his way back up

preview of Bush's campaign against Kerry?

Is it all going to be over Feb. 3rd?

DailyZomby #2: More Positive Qualities of the Democratic Candidates!

Why would anyone vote for a man who belonged to a secret society?

Enough with the Insider/Outsider mess already.

Arizona Deaniacs: Dean in Tucson on 1/31/04

The view from New Hampshire - John Edwards

Kerry attacked Dean before... TomPaine.com (Kerry will not be my leader)

Veterans may be ace up DLCer Kerry's sleeve

Kerry supporters: Who is the most formidable challenger to Kerry?

Alterman-Is Bush a 'Deserter'? It Doesn't Hurt to Ask

A Good poll site

Ralph Nader will run if Dean doesn't win!

What does Edwards have to do to survive 2/3?

We are going to war in Pakistan in the Spring before the election

Reminder on Clark:

Democratic Debate. When and Where will it air?

Now that Clinton has come out supporting Kerry, we better all fall in line

Dean: Doesn't Need to Win Any State Tues.

The Super bowl Effect

Clinton did not endorse Kerry per se.

So no one has dropped out after NH?

How many states will Kerry win on Feb 3rd ?

Begs someone to make this poll

Anyone know a link for streaming tonight's debate for we who are TV free?

States Kerry will win on Feb. 3rd (including confidence level)

What time is the debate tonight?

Neither Clinton has endorsed ANYONE

Clark hits on patriotism, faith, values in Arizona

5 days; $1,000,000.00; 15,880 people; $56.32 average contribution

GOP and Kerry playing the same Low game on Clark!

Kerry calls for firing of Tenent... deflecting scrutiny of WH?

How will Kerry deal with Bin Laden capture?

Clinton could not have endorsed Kerry - but he did endorse Dean.

Dean people who may be looking at other candidates

Dean is paying Car. Mosely Braun 20k per month, but staffers nothing?

Kerry is paying Kennedy 20k per month, but staffers nothing?

Dennis, Al Called It on WMD; Other Demos Bombed

There won't be a woman on the ticket this year

At what time and on what channel is the SC debate tonight?

Clinton DID NOT back Kerry

Bush is Unelectable

Msnbc Poll with good results for Kerry

Kerry will be a target

"The land mines awaiting John Kerry" - Joe Conason

My thoughts on tonight's debate

If Al Sharpton WINS South Carolina, How Seriously Would He Be Taken?

.

Debate reminder...I just received this email.......

Who would be the best VP choice for Clark?

Anyone else have this dilemma? Kerry or Clark ??

Kerry Support Found Across Wide Range of Democrats

Kerry's 2% finish in New Hampshire.

How will Kerry deal with the Bin Laden capture?

Tonight's Debate...Circular Firing Squad or....

Poll: Who do you support of among the three most likely candidates?

Will Clark win any of the states on Feb. 3?

Kerry's front-runner status turns up online dollars

I am so tired of Ralph Nader.

Bull and Groans

Forget the south? Are you kidding?

MSNBC Presidential Debate Thread #1

An interesting commentary from NYPress.com

"Prickless for President"

Please Forgive If Repost: The Scream Wasn't a Scream

Tom Brokenjaw is hosting the debate - here are his questions!

Debate simulcast here

Is there a bigger whore than Tom Brokaw?

Our guys are doing great in this debate! Congrats to everyone.

Is there a link for the debate that is not MSNBC?

MSNBC Presidential Debate Thread #2 - SC Debates

Kerry is not my guy, but he sure is a good advertisement for Botox. I

I polished off my crystal ball.

My response to the Kerry is Bush-lite meme

FAUX Analysis prediction

MSNBC Debate Thread #3

Who will take credit for the Osama/ Dean TV smear in Dec. - Before Iowa

MSNBC Debate Thread #4

Cost of War

Is Tom Brokaw an Islamophobe?

How can anyone criticize Brokaw here?!?! This is the BEST debate!

Buchanan: Kucinich and sharpton best debaters

How many non-Dean supporters are sickened by his media 'assasination'?

Post debate tear down the candidates time MSNBC.....

Kerry changes his tune on the Iraq war...

Who did the best job in the debate:

Grade the candidates' debate!

Democrats Agree They Must Win Over South

Best debate format because no buzzer. Bunnzers are demeaning.

DUPE

Shouldn't the issue of MONOPOLIES be being discussed??????

Late Primary State Residents Check In!

Out of the top three candidates, who do you support?

Quit a bad habit for the good Doctor Dean.

MSNBC Debate Thread #5

What is Wesley Clark's position on developing mini-nukes? nt

Political Compasses for the Candidates

Any other DUers who have NOT fallen in love with any candidate?

Is it just me,or does it appear that the presidential race has?

Vote for Dean to protest his media/DLC assassination!

Charlie Rangel vs James Clyburn ?? Who's the best endorsement ?

WP article on Clark's post-military consulting - via MSNBC site

debate transcript

Pick A Candidate Other Than The One You Support, Who Won The Debate

Has Kerry been robo-calling against Dean?

If someone besides Dean gets the nomination...

Who lost the debate?

The boys are back in town!

Kerry is calling for Tenet's resignation?!

A Kerry Nomination Leaves No Margin for Error

Is Kerry's sudden rise in popularity suspicious?

My thoughts on negativity, or what is worth a response

David Corn: Dis-endorsing Dean

Kerry isn't just running against Bush's record, he's running against his

Packed '04 Dem field proves Dems know Nader helped them in 00?

Has anybody else fallen in love with Al Sharpton?

Clarkies: How did the pundits spin The General's performance?

No longer ABB, now EBB

Has Trippi been robo-blogging against Kerry?

Did any of the candidates "tailor" their messages to Southern stereotypes?

Why the animosity between the Kerry and Dean supporters?

Dean supporters who feel "shafted by the Media / DNC" - 3rd party..IF he

New John Kerry Endorsement U.S. Rep Kendrick Meek - Miami

Anyone know how the $41Mill spent. Just heard its all gone. A record?

Latest Survey U.S.A. Arizona Polls:

Every dollar we give to Edwards counts double. Kerry/Dean's

If You Are A Dean Supporter Who Doesn't Attack Anyone - Don't Read This

New Poll Releases: Date and Times (ARG and Zogby)

DU'ers, How Do You Feel About John Edwards' High Praise for Iraqi War

How many non-Dean supporters are sick of talk about media assassinations?

Dean Supporters, Trippi isn't selling you out.

Latest ARG Arizona Polls:

Kucinich Question: Why was he so certain about WMDs?

is there a debate transcript up anywhere?

Taking out the frontrunner.

Today I convinced two Dem friends not to vote for Kerry under any

41 million down the toilet and all you talk about is Skulls and Botox?

Silly Silly Voters ...

The Superbowl Primary

Tonight's big winner = Al Sharpton (late due tivo)

Kerry's 2% finish in New Hampshire.

Can somebody please explain to me what Clinton said today?

I have to say it: I'm anybody but Kerry

More talking points

AL Sharpton on fire tonight !?

I missed the debate! What happened? Fill me in!

Dean never wanted the nomination....

What does Dean mean by this statement...?

Kerry's 91 Iraq vote: How do we respond?

Did Kerry make the "southern sale" this evening?

Tweety to Sharpton: Why did you pick the scab off election 2000?

I wish Kucinich and Lieberman would just drop out!

A Message from Roy Neel, his first blog post.

Who do you think 'won' the debate?

I was Zogby polled for the AZ primary

When is CNN going to put the debate

Out of the top FOUR candidates, whom do you support?

New SurveyUSA Missouri poll, Kerry way ahead, Edwards passes Dean for 2nd

Is Clark's position on Nafta and healthcare the same as all the others...?

Does the media supply a jet for the Democratic frontrunner's campaign?

Clark supporters, Can you please do me a favor, Puhleeeeezzzzz

Dean's comeback bat - fast approaching $1M - will hit it in 20 min!

Kerry Fires Ad Barrage

Kerry or Dean in charge of Iraq intelligence probe - who would you trust?

Does voting for the IWR take Iraq off the table in the GE?

Deleted message

Deleted message

Among those not in the race, whom would you support the most?

Who won the debate?

Edwards Tries to Benefit From Dean's Woes

I thought I was ABB until Kerry came out ahead

Will Dean attack Kerry at the debate?

I think the perfect song for the Dean campaign should be

Kerry won majority of young vote and anti-war vote in IA and NH

Stop Trashing Us Dean Supporters over our support for Dean

I'm sorrry but Brokaw is nothing more than a whore

Donate to Clark, Kucinich before the matching funds deadline!

A serious question: WHAT are John Kerry's national security credentials?

Debate Photos - what we didn't see

Kerry Is Unelectable

Lieberman scolds fellow Democrats for not standing up at SOTUS!

Clark redemption

Clark Supporters Check in...

To My Clark Supporters!

John Kerry's Voting Record

Michigan Gov. Granholm to endorse Kerry in presidential race

Results of MSNBC poll on best debate performance

Juicy Wesley Clark/Peter Jennings gossip!

Has Kerry been robo-calling against Dean?

"I made a mistake when I Supported the IWR" = Political Suicide?

Kerry defends defense record- "flattered" by GOP attack

The Right Kind of "Populism" - Kerry, Edwards

Who would you rather share a bomb shelter with?

Fellow Dean supporters, have you seen this yet?

A Kerry ticket leaves no margin for error in the general election

MSGOP Poll: Who won?

Delegate reminder: Dean still leads

Bush Campaign will attack Kerry hard now ... Get ready Kerry

"I'm A Republican and I'm Voting For Kerry!"

Deleted message

I got an audio postcard from some WmRiversPitt guy. Kucinich email

Serious question. What really makes Dean different?

John Kerry: "An Unexpected Powerhouse," by WP Harold Meyerson

Does anyone from a southern state believe Kerry

Here's a stress-breaker--beat Bush today

The dems are missing the boat on this one. We should be uniting

Some thoughts about Carol M-B's weird candidacy.

Deleted message

Does the far left have to win more elections to prove they are right?

Unrepresentative Democracy

Keep supporting your candidate - but be prepared to FALL IN LINE!

For those who stand by the IWR litmus test + won't vote "pro-war" can

When was the last time an insider defeated an incumbent president?

Why are you or aren't you ABB? (Anybody But Bush)

"American Son" to air in Oklahoma

Gephardt best VP for Kerry?

MSNBC...CLARK...gave speech to group with terrorist ties??

Skull and Bones

so who is running as a delegate to the national convention

A CHEER for TRIPPI. Very Gracious Interview w Passion for People & Change

I don't want it to be over Feb. 3. Do you?

What are your 2004 Dream tickets?

Kerry Raises $500,000 Online in Two Days

Dean leads in delegate count?

Things that irk me about the race and DU at the moment...

Lest we forget: Delegates, not primary/caucus wins, are what count

How many "Nobody but Kerry" posts have you seen? (General Election)

DU Kerry Support Poll - If the Dem Primary were held tomorrow ?

Al Sharpton's Gift to America

Robert Reich (Who Works For Kerry) On Moderates And The DLC !!!

Astounding example of Kerry Doublespeak

Edwards Supporters: Convince Me

TV Alert - Joe Trippi on MSNBC next with Deborah Norville...let's hear it.

Calling all Kucinich supporters

OMG- William Rivers Pitt in my Mailbox! Kucinich for President!

DK just said PNAC!!!

"I will defend any candidate against media assassination"

If the nominee is chosen before my state's primary, ...

If Kerry wins the nomination, who would you like to see in VP slot?

Is Gore Taking over Dean Campaign to Do a Dignified Merger w Kerry

Why do people hate Howard Dean?

Order of preference on remaining candidates?

Kerry has no leverage on war issues.

I've looked at the candidates again.........

PNAC Project Director Contributes to Kerry

Why Won't Media Talk About Clark Who is Running Ahead of Dean & Edwards?

Dean Folk: Should Trippi Join the Kerry Campaign? Or off to Bahamas?

END